Sociedad Americana de Hirudoterapia

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Research article published in Cellular and molecular biology (Noisy-le-Grand, France) (2024)

Última actualización: June 18, 2026Revisado por: ASH Editorial Board
Research article — evidence reviewArticle reference
Evidence: Preclinical (animal)Genómica y proteómicaJawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024

Abstract

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Abstract sourced from PubMed (NCBI) for the cited record. See the original publication for the authoritative version.

Publication typeJournal Article
Indexed MeSH termsAnimalsHirudo medicinalisDNA, RibosomalPondsLeechesDNA Primers

Resumen

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region).

Por qué esto importa para la hirudoterapia

Este estudio proporciona confirmación morfológica y molecular (18S rDNA) de que 23 ejemplares de sanguijuela recolectados en el estanque Felaw, en la región del Kurdistán de Irak, pertenecen a Hirudo medicinalis, reportando el primer registro documentado de esta especie en Irak. Para la hirudoterapia y el ámbito de la ASH, la identificación taxonómica precisa y el mapeo biogeográfico de H. medicinalis—la principal sanguijuela medicinal—son fundamentales, ya que la identidad de la especie sustenta directamente el abastecimiento, la conservación y cualquier investigación consistente, ya sea terapéutica o del secretoma salival. El alcance del estudio se limita a la documentación taxonómica y distributiva; no investiga la hirudoterapia, los resultados clínicos, los componentes salivales ni la bioactividad. Además, el muestreo se limitó a un solo estanque con un número relativamente reducido de ejemplares, por lo que conclusiones más amplias sobre la población o la región quedan pendientes de trabajos de prospección adicionales.

Citación

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Jawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024

Contexto clínico relacionado

Añadido a la biblioteca ASH: March 18, 2026 · Última actualización del sitio: June 18, 2026

Este sitio web proporciona información educativa y no constituye consejo médico, diagnóstico ni recomendaciones de tratamiento. La terapia con sanguijuelas medicinales conlleva riesgos clínicamente significativos y debe ser realizada únicamente por profesionales calificados bajo protocolos aprobados institucionalmente. La autorización 510(k) de la FDA para sanguijuelas medicinales se limita a indicaciones específicas; las discusiones sobre uso investigativo y fuera de indicación se señalan correspondientemente. Para orientación médica específica, consulte a un profesional de salud calificado.