18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond
Research article published in Cellular and molecular biology (Noisy-le-Grand, France) (2024)
Abstract
Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.
Abstract sourced from PubMed (NCBI) for the cited record. See the original publication for the authoritative version.
Zusammenfassung
Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region).
Warum dies für die Hirudotherapie relevant ist
Diese Studie liefert eine morphologische und molekulare (18S-rDNA) Bestätigung, dass 23 aus dem Felaw-Teich in der irakischen Region Kurdistan gesammelte Egelspezimen zu Hirudo medicinalis gehören, und berichtet über den ersten dokumentierten Nachweis dieser Art im Irak. Für die Hirudotherapie und den Bereich von ASH sind eine präzise taxonomische Identifizierung und die biogeografische Kartierung von H. medicinalis – des wichtigsten medizinischen Egels – von grundlegender Bedeutung, da die Artidentität unmittelbar die Grundlage für Beschaffung, Arterhaltung und jede konsistente therapeutische oder Speichelsekretom-Forschung bildet. Der Umfang der Studie beschränkt sich auf taxonomische und verbreitungskundliche Dokumentation; sie untersucht weder Hirudotherapie noch klinische Ergebnisse, Speichelbestandteile oder Bioaktivität. Darüber hinaus beschränkte sich die Probenahme auf einen einzigen Teich mit einer relativ geringen Anzahl von Spezimen, sodass weiterreichende populations- oder regionalspezifische Schlussfolgerungen weitere Erhebungsarbeiten erforderlich machen.
Zitation
18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.
Jawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024
Verwandter klinischer Kontext
Erfahren Sie, wie diese Forschung mit der klinischen Praxis verknüpft ist
Zur ASH-Bibliothek hinzugefügt: March 18, 2026 · Letzte Aktualisierung der Website: 18. Juni 2026