18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Abstract sourced from PubMed (NCBI) for the cited record. See the original publication for the authoritative version.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region).

Erfahren Sie, wie diese Forschung mit der klinischen Praxis verknüpft ist

More peer-reviewed studies in Genomik & Proteomik.

• 434 Salivary Proteins — Integrated Proteomics of Hirudo medicinalis — Liu et al. (2019)
• Medicinal Leech Genome Assembly — Anticoagulant Gene Catalog — Kvist et al. (2020)
• Species Identification of Medicinal Leeches — Molecular Taxonomy — Siddall ME et al. (2007)
• Draft Genome of Hirudo medicinalis — BMC Genomics — Kvist S et al. (2020)
• Comparative Transcriptomics of Three Hirudo Species — Babenko VV et al. (2020)
• Effects of hirudotherapy on liver functions, lipid profile, and insulin sensitivity in rats with metabolic syndrome — Bilden A et al. (2026)
• Efficacy and Safety of Hirudotherapy for Improving Sperm Quality Parameters in Male Infertility: A Randomized Controlled Trial — Abtahi-Forooshani M et al. (2026)
• Hirudotherapy in Wound Healing — Nair H et al. (2022)
• [Medicinal leeches and hirudotherapy] — Gödekmerdan A et al. (2011)
• [Cutaneous pseudolymphoma after hirudotherapy : Case report and review] — Hanner S et al. (2022)