Американское общество гирудотерапии

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Research article published in Cellular and molecular biology (Noisy-le-Grand, France) (2024)

Последнее обновление: March 18, 2026Рецензент: ASH Editorial Board
Research article — evidence reviewArticle reference
Геномика и протеомикаJawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024

Abstract

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Abstract sourced from PubMed (NCBI) for the cited record. See the original publication for the authoritative version.

Publication typeJournal Article
Indexed MeSH termsAnimalsHirudo medicinalisDNA, RibosomalPondsLeechesDNA Primers

Резюме

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region).

Почему это важно для гирудотерапии

Expands the genomic and molecular understanding of medicinal leeches and their bioactive repertoire.

Цитирование

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Jawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024

Связанный клинический контекст

Узнайте, как это исследование связано с клинической практикой

Добавлено в библиотеку ASH: March 18, 2026 · Последнее обновление сайта: March 18, 2026

Этот сайт предоставляет образовательную информацию и не является медицинской консультацией, диагнозом или рекомендацией по лечению. Гирудотерапия сопряжена с клинически значимыми рисками и должна проводиться только квалифицированными клиницистами в рамках институционально утверждённых протоколов. Разрешение FDA 510(k) для медицинских пиявок ограничено определёнными показаниями; обсуждения исследовательского и нелицензионного применения отмечены соответствующим образом. Для индивидуальных медицинских рекомендаций обратитесь к квалифицированному медицинскому специалисту.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond | ASH