18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Abstract sourced from PubMed (NCBI) for the cited record. See the original publication for the authoritative version.

Morphological examination and partial 18s rDNA sequencing of 23 leeches collected from Felaw Pond, Iraq, between January and July 2023 confirmed all specimens as Hirudo medicinalis, representing the first record of this species in Iraq.

Explore how this research connects to clinical practice

More peer-reviewed studies in Genomics & Proteomics.

• Leech Salivary Proteome and Transcriptome: 434 Deduced Protein Sequences — Liu Z, Tong X, Su Y, et al. (2019)
• Medicinal Leech Draft Genome — Anticoagulant Gene Survey — Kvist S, Manzano-Marín A, de Carle D, Trontelj P, Siddall ME (2020)
• Leech therapy (Hirudo medicinalis) attenuates testicular damages induced by testicular ischemia/reperfusion in an animal model — Davoodi F et al. (2021)
• New anticoagulant protein from medicinal leech — Manuvera V et al. (2024)
• AIF-1 and RNASET2 Play Complementary Roles in the Innate Immune Response of Medicinal Leech — Baranzini N et al. (2019)
• Medicinal leech antimicrobial peptides lacking toxicity represent a promising alternative strategy to combat antibiotic-resistant pathogens — Grafskaia E et al. (2019)
• Structural insights into thrombolytic activity of destabilase from medicinal leech — Marin E et al. (2023)
• The genome of medicinal leech (Whitmania pigra) and comparative genomic study for exploration of bioactive ingredients — Tong L et al. (2022)
• Medicinal Leech CNS as a Model for Exosome Studies in the Crosstalk between Microglia and Neurons — Raffo-Romero A et al. (2018)
• Transcriptomic profiling and the first spatial expression analysis of candidate genes in the salivary gland of the East Asian medicinal leech, Hirudo nipponia — Kim J et al. (2024)

Browse all ASH-analysed research →