American Society of Hirudotherapy

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond

Research article published in Cellular and molecular biology (Noisy-le-Grand, France) (2024)

Last Updated: June 18, 2026Reviewed by: ASH Editorial Board
Research article — evidence reviewArticle reference
Evidence: Preclinical (animal)Genomics & ProteomicsJawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024

Abstract

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Abstract sourced from PubMed (NCBI) for the cited record. See the original publication for the authoritative version.

Publication typeJournal Article
Indexed MeSH termsAnimalsHirudo medicinalisDNA, RibosomalPondsLeechesDNA Primers

Summary

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region).

Why This Matters for Hirudotherapy

This study provides morphological and molecular (18S rDNA) confirmation that 23 leech specimens collected from Felaw Pond in Iraq's Kurdistan region belong to Hirudo medicinalis, reporting the first documented record of this species in Iraq. For hirudotherapy and ASH's domain, accurate taxonomic identification and biogeographic mapping of H. medicinalis—the principal medicinal leech—are foundational, as species identity directly underpins sourcing, conservation, and any consistent therapeutic or salivary-secretome research. The study's scope is limited to taxonomic and distributional documentation; it does not investigate hirudotherapy, clinical outcomes, salivary components, or bioactivity. Additionally, sampling was confined to a single pond with a relatively small number of specimens, so broader population or regional conclusions await further survey work.

Citation

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Jawdat Bilal S · Cellular and molecular biology (Noisy-le-Grand, France), 2024

Added to ASH library: March 18, 2026 · Site last updated: June 18, 2026

This website provides educational information and does not constitute medical advice, diagnosis, or treatment recommendations. Medicinal leech therapy carries clinically meaningful risks and should be performed only by qualified clinicians under institutionally approved protocols. FDA 510(k) clearance for medicinal leeches is limited to specific indications; investigational and off-label discussions are labeled accordingly. For patient-specific guidance, consult a qualified healthcare provider.